World Rare Disease Day 2028

Need ideas? Here’s another one. Why wait? For the World Rare Disease Day of 2028, try to write your own name using the DNA coding. I will do it for my own name, Renata Szyszka.

To write my name using the DNA alphabet, we need to:

The DNA alphabet has only four letters: A, T, C, and G. Since my name contains other letters, it can’t be directly written as DNA without using an encoding scheme. One simple way is to convert each letter into its 8-bit ASCII binary code and then map binary to DNA: 00 → A; 01 → C; 10 → G; 11 → T

Using that encoding, “Renata Szyszka” becomes:

5'-CCAG CGCC CGTG CGAC CTCA CGAC AGAA CCAT CTGG CTGC CTAT CTGG CGGT CGAC-3'
This is an artificial encoding, not a real gene or naturally occurring DNA sequence.

Here is the explanation of how to convert letters to binary:

The conversion happens in two steps:

  1. Convert each character to its ASCII value, then to an 8-bit binary number. Notice that, capital and small letters have a different coding.
  2. Convert every 2 bits into one DNA base using a fixed mapping.

For the DNA mapping, I used:

Example: the letter R
  1. ASCII value of R is 82.
  2. 82 in 8-bit binary is: 01010010
  3. Split into pairs: 01 01 00 10
  4. Convert each pair: 01 → C; 01 → C; 00 → A; 10 → G
  5. So:

R → 01010010 → CCAG

  1. The ASCII code for a space is 32,
  2. which in binary is: 00100000
  3. Split into pairs: 00 10 00 00
  4. Using the mapping: 00 → A; 10 → G; 00 → A; 00 → A

the DNA encoding for a space is: AGAA. So the corrected encoding should contain ... CGAC AGAA TCCA ..., where:

  • CGAC = a
  • AGAA = space
  • TCCA = S

The complete corrected sequence is therefore:

CCAGCGCCCGTGCGACCTCACGACAGAACCATCTGGCTGCCTATCTGGCGGTCGAC
CharacterASCIIBinaryDNA
R8201010010CCAG
e10101100101CGCC
n11001101110CGTG
a9701100001CGAC
t11601110100CTCA
a9701100001CGAC
(space)3200100000AGAA
S8301010011CCAT
z12201111010CTGG
y12101111001CTGC
s11501110011CTAT
z12201111010CTGG
k10701101011CGGT
a9701100001CGAC

World Rare Disease Day 2027

Clinical trial endpoints for Leber’s Congenital Amaurosis type 10 (CEP290-associated LCA) often focus on measurable functional gains—such as improvements in visual acuity, light sensitivity, or navigation under low-light conditions—yet these outcomes can feel modest compared to patients’ hopes for meaningful, life-changing vision restoration. Patients and families frequently expect transformative therapies, driven by the promise of gene editing (*AONs are not gene editing) and early successes in other retinal diseases, while scientists and physicians must work within the biological constraints of photoreceptor degeneration, delivery limitations of therapies, and safety concerns that necessitate cautious, incremental progress. This gap arises from both the complexity of CEP290 mutations—particularly the challenge of targeting large genes or specific intronic variants—and the still-evolving nature of retinal RNA-based technologies. To reduce the risk of research becoming disease-centered rather than patient-centered, trial design must incorporate endpoints that reflect real-world visual function and quality of life, alongside continuous patient engagement to align goals, expectations, and definitions of meaningful benefit.

Continuous incorporation of patients’ perspective is crucial at every stage of clinical trials- this year’s 2027, World Rare Disease Day will focus on exactly that task.

World Rare Disease Day 2026

The immune system in the eye is essential for preserving the eye’s non-inflammatory state and for preserving healthy eyesight. The human eye is inherently equipped with immune response mechanisms to preserve its visual functions. The innate and adaptive immune responses to infection are initiated in many retinal diseases, as well as, after the administration of a specific medicine. Immune reactions in treated individuals may occur, which not only could negatively affect the patients, but cause the AON to be quickly destroyed and removed from the body before it can fully implement its therapeutic impact, as well. Which, of the many immonological factors of the human body, could be causing the rapid disappearance of the oligo molecule, thereby reducing its effectiveness? With very few patients in clinical trials, not much ethnic diversity, these questions are not straightforward to answer.

This World Rare Disease Year 2026 will focus on the unresolved immune responses to determine precisely how the dynamic biochemical processes in the eye affect the therapy of LCA10.

World Rare Disease Day 2025

I appreciate you taking part in WRDD24, and I hope to see you in 2025.

If you’re part of my tribe and ever find yourself lost, consider this your roadmap to where you belong—and where you truly fit in. How far back into the past can you travel to discover your mitochondrial Eve? Explore your family’s origins and genetic heritage while playing a fun and engaging game.

OR

#raredisease #WRDD2025 #ChildAdvocay
(picture of Pola Torno taken by Lena 9 y.o., March 2024)

World Rare Disease Day 2024

Delivery is as important as technology.

It is still exceedingly difficult to create new administration methods and drug delivery systems that can deliver medication to the back of the eye. There is still a need for minimally invasive methods of medication administration to the retina. A variety of approaches, including intravitreal injections, implants, nanoparticles, hydro-gels, and others, have been identified as potential administration routes. However, the majority of them have drawbacks.
For instance, the need for multiple injections, the high cost of those repeated treatments, or the long-term intrusive consequences become substantial obstacles for patients. Other, less intrusive administration methods, like the topical route, for example, lessen the burden of treatment but also restrict the drug’s bioavailability and effectiveness in the retinal area of the eye.

It would be better to use highly specific delivery vesicles or medications that would quickly reach photo-receptor cells (PR) once within the vitreous posterior region of the eyeball, but creating such substances continues to be a difficult task. Many molecular modalities have failed to get through the neuronal retina and reach the photo-receptor cells, which are the most important cellular target. (An example Ocular Drug Delivery review by Hyeong Min Kim and Se Joon Woo, 2021)

The focus for this year World Rare Disease Day 2024, is to examine delivery systems for the bare oligonucleotides (AONs) in LCA10 in greater detail.

World Rare Disease Day 2023

Why isn’t there a cure for Leber’s Congenital Amaurosis, yet? – Because human biology is not simple.

The goal for the year 2023 is: To further expand on collaborations of multidisciplinary research, incorporating Genome-Wide Association Studies (GWAS) needed to gain insight into gene sets and pathways, as well as regulatory single nucleotide polymorphism (SNPs) that influence gene expression of the gene causing disease. To demonstrate how human disease-associated SNPs which lie in the non-coding genome affect both, gene expression and the chemical molecules used as a therapeutic remedy. To address genetic differences between ethnic populations, and explain how these differences affect how well the eye responds to treatments in those different cohorts. (Read more on the subject here. BBC Website entered on 22.04.2023)

World Rare Disease Day 2022

Share Your Colours. Everyone’s welcome! Whether you are a research scientist working in the laboratory with cell cultures, or a physician who is testing a new drug in clinical trials, a patient’s caregiver physically exhausted and emotionally taxed, or perhaps you are a politician coming up with new policies to improve healthcare accessibility – we warmly invite you to join us to celebrate yet another World Rare Disease Day on February 28th, 2022.

The goal is to do good. Ask a question, propose a novel idea, finance Research and Development facilities, sponsor upgrades to regulatory systems, move forward with mergers and acquisitions, assimilate industry partners, or use your talents to provide continuous support to the rare disease community. 2022 is looking forward to becoming your Rare Friend. Join the community. #ShareYourColours.

This year to celebrate World Rare Disease Day we will be sending special souvenirs, a gift of “rare awareness”- a bookmark, a token of remembrance of our lasting journey together.

Share your colors with EURORDIS @
https://www.rarediseaseday.org/

Virtual World Rare Disease Day 2021

To foster old partnerships and strengthen new long-lasting collaborations where innovation thrives in the research and development landscape. To establish even more ethical pathways for drug development while emphasizing respect and dignity for the trusting and the dependent patient. Show your stripes. During the Covid-19 year, our work was filled with intense online interactions.

#ShowYourStripes #RareDiseaseDay
Build Wealth Through Knowledge

Follow the link to take Quiz 1 created on the 15th. of 06.2020. Assess your knowledge. Enjoy! Receive the answers you need here. TEST Yourself and have fun. This is the BETTER (not BEST yet) rare disease simple challenge my creative mind could come up with! 🙂 The Next edition will be more advanced… It shall be designed for large teams to play against each other. The winners can dedicate their prize to a Foundation. For instance to fight blindness.

World Rare Disease Day 2020

The main goal is to take action steps towards curing a rare type of childhood blindness called Leber’s Congenital Amaurosis. The goal is also to inspire. Make YOUR day a special one!

Join us for one of a kind, the BLINDFOLD FOOD TASTE DATE. Or organize your own, private, with a close friend.

A new 13th World Rare Disease Day campaign will start soon. It is just about time to plan events and spice activities up. Let’s start preparations, let’s reach the remote locations, let’s focus on what matters, and once again beat the odds. Become a friend of rare disease day at Eurordis, Global Genes, or show your stripes in pictures at NORD.

Data is the new oil. Genetic data can be priceless. DNA, or deoxyribonucleic acid, is the hereditary material present inside nearly every cell of the human body. DNA stores information as a code comprising four bases adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases organized in a specific sequence. Whole-genome sequencing reveals highly accurate information about the individual and can indicate preventable diseases. However, because it is so powerful not only can it reveal personal health information about the person undergoing diagnosis but it can identify diseases passed between close genetic relatives, as well.

How do you understand consent, privacy, or ownership of your genetic tests? Are YOU the owner of your most personal information? Are you, perhaps, a caregiver who has to make the most difficult decisions on behalf of someone you love dearly …with their best interest at your heart? Would you feel obliged and responsible to inform your relatives about their potential future health risks?

While celebrating a rare disease patient’s journey from its most vulnerable perspective we can keep reflecting on these crucial questions. On the 29th of February 2020, we will be raising awareness about Leber’s Congenital Amaurosis (LCA10) in the most inspiring settings with the blindfold food taste test. THIS! will. be. fun.

#ShowYourStripes on #RareDiseaseDay. Make a meaningful impact. Share with a hashtag #Leber #Blindness #RareDisease #Cep290 #Lca10.

2020 National Virtual VisionWalk with Foundation Fighting Blindness

On Saturday 06.June.2020 we joined internationally to celebrate National Virtual VisionWalk Day with Foundation Fighting Blindness! We are on. Together, we’re taking steps to fight blinding diseases! After an exciting virtually held opening ceremony, we head for a live open-air stroll to help accelerate research towards a cure for retinal diseases. #VisionWalkStrong #LeberCongenitalAmaurosis

World Rare Disease Day 2019

We want to thank everyone who actively participated in this unforgettable, full of support and engaging day. We hope you will join us in abundance to celebrate together with us again next year.

The goal is to adopt new behaviors and attitudes towards the needs of blind people, help with early diagnosis, and access future treatments that are currently under development for LCA10.

Patients affected by rare diseases are important because currently for most disease cases there are no cures. Many young children go undiagnosed due to the limited accessibility to specialized care as well as the costs of genetic testing. Rare Disease Day has been established to improve knowledge amongst the general public and voice the concerns of major decision-makers to address the needs of those living with rare diseases.

February 28th, 2019 is celebrating World Day for People with Rare Diseases, usually genetic. I encourage you to take part in it!  Why? Because shutting down eyes open up minds. We organize an event related to Leber’s Congenital Amaurosis blindness – a competition for artistic work with blindfolded eyes. If you would like to join the fun, I warmly invite you to do so. In the family circle, education is through play. “From children to children” learning through understanding. While learning about challenges in the diagnosis of this rare form of childhood blindness reflect how you feel when you do not see much?

Blindness is a SERIOUS health condition and needs to be understood. BE SAFE! Be responsible.

Do something “in the dark”, blindfolded: dress a doll, draw a picture, eat dinner with a handkerchief covering your eyes, and capture the memory (!) by taking pictures or a video (with the Rare Disease Day logo). Share with us as a family, class, school, university, hospital, or company at Eurordis or NORD.

Time until February! Have fun.


#ShowYourRare #RareDisease #Blindness #OrphanDrugs #Cep290 #Lca10 #Leber #Eye

World Rare Disease Day 2017

Vascobelo- supposedly Belgian finest blend when it comes to both coffee and chocolate. A barista’s first choice. Indeed, it melts in your mouth. Lovely. We will have a splendid time here. I am participating in several tours this year. I am open to interesting adventures and excited about the incredible opportunity to meet new travel professionals. Building a personal brand in this metaphoric environment shall be a unique chance to infiltrate the brilliant minds of star experts coming from diverse backgrounds unrelated to medicine and health care.

Rare Disease Day is an international awareness campaign led by the patient organizations EURORDIS, NORD, and Global Genes among others. Together they ally close to a thousand rare disease patient organizations and individuals who are actively promoting research on rare diseases, supporting commercial development of orphan drugs, and most of all are devoted to improving the lives of patients and families suffering from horrific rare diseases.

Every last day of February (this year February 28, 2017) hundreds of other patient organizations around the world join events dedicated to Rare Disease Day. This year’s slogan states ‘With research, possibilities are limitless’.

I feel honored to speak on behalf of the Rare Disease community during these informal tour gatherings. With a story of how much can be achieved within a year without massive resources only equipped with strong determination and goodwill, I am happily sharing thoughts on how important the role of patients in research is. I enthusiastically describe how challenging the development of new therapies can be.

I intend to educate and plant a seed of curiosity among those who never experienced the life-threatening, incurable disease. This is the time I can share the most exhilarating story about Leber’s Congenital Amaurosis struggles. I speak about the tools we need to provide to help patients thrive and realize their most intimate dreams. By accumulating ideas others can obtain a diversified perspective of people living with rare diseases. I highlight the significance of research and passionately press for appreciation for the meaningful role patients play in research & development. The image I strive to paint in my fellow travelers’ minds hopefully allows them to refine their understanding of blind people and eventually makes them gain respect for patients that are the driving force in the efforts into finding curable medicines.

#ShowYourRare #RareDisease #Blindness #OrphanDrugs #Cep290 #Lca10 #Leber #Eye